ID: 1134706440

View in Genome Browser
Species Human (GRCh38)
Location 16:16306731-16306753
Sequence CCTCCAGGAAAGCCGGCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134706431_1134706440 1 Left 1134706431 16:16306707-16306729 CCCAAGTCCCTGTCTCCAGCTCT No data
Right 1134706440 16:16306731-16306753 CCTCCAGGAAAGCCGGCGGAAGG No data
1134706433_1134706440 -6 Left 1134706433 16:16306714-16306736 CCCTGTCTCCAGCTCTGCCTCCA No data
Right 1134706440 16:16306731-16306753 CCTCCAGGAAAGCCGGCGGAAGG No data
1134706429_1134706440 10 Left 1134706429 16:16306698-16306720 CCACATCCACCCAAGTCCCTGTC No data
Right 1134706440 16:16306731-16306753 CCTCCAGGAAAGCCGGCGGAAGG No data
1134706432_1134706440 0 Left 1134706432 16:16306708-16306730 CCAAGTCCCTGTCTCCAGCTCTG No data
Right 1134706440 16:16306731-16306753 CCTCCAGGAAAGCCGGCGGAAGG No data
1134706430_1134706440 4 Left 1134706430 16:16306704-16306726 CCACCCAAGTCCCTGTCTCCAGC No data
Right 1134706440 16:16306731-16306753 CCTCCAGGAAAGCCGGCGGAAGG No data
1134706434_1134706440 -7 Left 1134706434 16:16306715-16306737 CCTGTCTCCAGCTCTGCCTCCAG No data
Right 1134706440 16:16306731-16306753 CCTCCAGGAAAGCCGGCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134706440 Original CRISPR CCTCCAGGAAAGCCGGCGGA AGG Intergenic
No off target data available for this crispr