ID: 1134709025

View in Genome Browser
Species Human (GRCh38)
Location 16:16319099-16319121
Sequence GGCGAGACCCACAGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134709025_1134709032 -9 Left 1134709025 16:16319099-16319121 CCCTGCCCACTGTGGGTCTCGCC No data
Right 1134709032 16:16319113-16319135 GGTCTCGCCAAAAAACTTGGGGG No data
1134709025_1134709031 -10 Left 1134709025 16:16319099-16319121 CCCTGCCCACTGTGGGTCTCGCC No data
Right 1134709031 16:16319112-16319134 GGGTCTCGCCAAAAAACTTGGGG No data
1134709025_1134709036 26 Left 1134709025 16:16319099-16319121 CCCTGCCCACTGTGGGTCTCGCC No data
Right 1134709036 16:16319148-16319170 TTGTGCCCAGTGAAGATGGTTGG No data
1134709025_1134709037 27 Left 1134709025 16:16319099-16319121 CCCTGCCCACTGTGGGTCTCGCC No data
Right 1134709037 16:16319149-16319171 TGTGCCCAGTGAAGATGGTTGGG No data
1134709025_1134709035 22 Left 1134709025 16:16319099-16319121 CCCTGCCCACTGTGGGTCTCGCC No data
Right 1134709035 16:16319144-16319166 TTGCTTGTGCCCAGTGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134709025 Original CRISPR GGCGAGACCCACAGTGGGCA GGG (reversed) Intergenic
No off target data available for this crispr