ID: 1134709270

View in Genome Browser
Species Human (GRCh38)
Location 16:16320064-16320086
Sequence AGCCATTGGCGCAGGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134709270_1134709281 3 Left 1134709270 16:16320064-16320086 CCCCCAGGCCTGCGCCAATGGCT No data
Right 1134709281 16:16320090-16320112 CGTCAGGGCCAGGGCTACTCGGG No data
1134709270_1134709280 2 Left 1134709270 16:16320064-16320086 CCCCCAGGCCTGCGCCAATGGCT No data
Right 1134709280 16:16320089-16320111 ACGTCAGGGCCAGGGCTACTCGG No data
1134709270_1134709283 21 Left 1134709270 16:16320064-16320086 CCCCCAGGCCTGCGCCAATGGCT No data
Right 1134709283 16:16320108-16320130 TCGGGTCCCCCTATGCGCTATGG No data
1134709270_1134709279 -6 Left 1134709270 16:16320064-16320086 CCCCCAGGCCTGCGCCAATGGCT No data
Right 1134709279 16:16320081-16320103 ATGGCTGCACGTCAGGGCCAGGG No data
1134709270_1134709278 -7 Left 1134709270 16:16320064-16320086 CCCCCAGGCCTGCGCCAATGGCT No data
Right 1134709278 16:16320080-16320102 AATGGCTGCACGTCAGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134709270 Original CRISPR AGCCATTGGCGCAGGCCTGG GGG (reversed) Intergenic
No off target data available for this crispr