ID: 1134710140

View in Genome Browser
Species Human (GRCh38)
Location 16:16323603-16323625
Sequence CAGGCTCCCAAGCCACGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134710140_1134710155 29 Left 1134710140 16:16323603-16323625 CCCGCACGTGGCTTGGGAGCCTG No data
Right 1134710155 16:16323655-16323677 CCGTTCACCCCGGGCTCCTCAGG No data
1134710140_1134710148 1 Left 1134710140 16:16323603-16323625 CCCGCACGTGGCTTGGGAGCCTG No data
Right 1134710148 16:16323627-16323649 GACCCTTAAGGCTGGGCCGCAGG No data
1134710140_1134710146 -6 Left 1134710140 16:16323603-16323625 CCCGCACGTGGCTTGGGAGCCTG No data
Right 1134710146 16:16323620-16323642 AGCCTGGGACCCTTAAGGCTGGG No data
1134710140_1134710153 20 Left 1134710140 16:16323603-16323625 CCCGCACGTGGCTTGGGAGCCTG No data
Right 1134710153 16:16323646-16323668 CAGGTGCAGCCGTTCACCCCGGG No data
1134710140_1134710152 19 Left 1134710140 16:16323603-16323625 CCCGCACGTGGCTTGGGAGCCTG No data
Right 1134710152 16:16323645-16323667 GCAGGTGCAGCCGTTCACCCCGG No data
1134710140_1134710145 -7 Left 1134710140 16:16323603-16323625 CCCGCACGTGGCTTGGGAGCCTG No data
Right 1134710145 16:16323619-16323641 GAGCCTGGGACCCTTAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134710140 Original CRISPR CAGGCTCCCAAGCCACGTGC GGG (reversed) Intergenic