ID: 1134710147

View in Genome Browser
Species Human (GRCh38)
Location 16:16323622-16323644
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134710147_1134710161 17 Left 1134710147 16:16323622-16323644 CCTGGGACCCTTAAGGCTGGGCC No data
Right 1134710161 16:16323662-16323684 CCCCGGGCTCCTCAGGCGGGGGG No data
1134710147_1134710157 14 Left 1134710147 16:16323622-16323644 CCTGGGACCCTTAAGGCTGGGCC No data
Right 1134710157 16:16323659-16323681 TCACCCCGGGCTCCTCAGGCGGG No data
1134710147_1134710152 0 Left 1134710147 16:16323622-16323644 CCTGGGACCCTTAAGGCTGGGCC No data
Right 1134710152 16:16323645-16323667 GCAGGTGCAGCCGTTCACCCCGG No data
1134710147_1134710159 16 Left 1134710147 16:16323622-16323644 CCTGGGACCCTTAAGGCTGGGCC No data
Right 1134710159 16:16323661-16323683 ACCCCGGGCTCCTCAGGCGGGGG No data
1134710147_1134710155 10 Left 1134710147 16:16323622-16323644 CCTGGGACCCTTAAGGCTGGGCC No data
Right 1134710155 16:16323655-16323677 CCGTTCACCCCGGGCTCCTCAGG No data
1134710147_1134710153 1 Left 1134710147 16:16323622-16323644 CCTGGGACCCTTAAGGCTGGGCC No data
Right 1134710153 16:16323646-16323668 CAGGTGCAGCCGTTCACCCCGGG No data
1134710147_1134710156 13 Left 1134710147 16:16323622-16323644 CCTGGGACCCTTAAGGCTGGGCC No data
Right 1134710156 16:16323658-16323680 TTCACCCCGGGCTCCTCAGGCGG No data
1134710147_1134710158 15 Left 1134710147 16:16323622-16323644 CCTGGGACCCTTAAGGCTGGGCC No data
Right 1134710158 16:16323660-16323682 CACCCCGGGCTCCTCAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134710147 Original CRISPR GGCCCAGCCTTAAGGGTCCC AGG (reversed) Intergenic