ID: 1134710149

View in Genome Browser
Species Human (GRCh38)
Location 16:16323629-16323651
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134710149_1134710156 6 Left 1134710149 16:16323629-16323651 CCCTTAAGGCTGGGCCGCAGGTG No data
Right 1134710156 16:16323658-16323680 TTCACCCCGGGCTCCTCAGGCGG No data
1134710149_1134710167 28 Left 1134710149 16:16323629-16323651 CCCTTAAGGCTGGGCCGCAGGTG No data
Right 1134710167 16:16323680-16323702 GGGGGCTTCTGCCGAGCGGGTGG No data
1134710149_1134710158 8 Left 1134710149 16:16323629-16323651 CCCTTAAGGCTGGGCCGCAGGTG No data
Right 1134710158 16:16323660-16323682 CACCCCGGGCTCCTCAGGCGGGG No data
1134710149_1134710157 7 Left 1134710149 16:16323629-16323651 CCCTTAAGGCTGGGCCGCAGGTG No data
Right 1134710157 16:16323659-16323681 TCACCCCGGGCTCCTCAGGCGGG No data
1134710149_1134710153 -6 Left 1134710149 16:16323629-16323651 CCCTTAAGGCTGGGCCGCAGGTG No data
Right 1134710153 16:16323646-16323668 CAGGTGCAGCCGTTCACCCCGGG No data
1134710149_1134710161 10 Left 1134710149 16:16323629-16323651 CCCTTAAGGCTGGGCCGCAGGTG No data
Right 1134710161 16:16323662-16323684 CCCCGGGCTCCTCAGGCGGGGGG No data
1134710149_1134710166 25 Left 1134710149 16:16323629-16323651 CCCTTAAGGCTGGGCCGCAGGTG No data
Right 1134710166 16:16323677-16323699 GCGGGGGGCTTCTGCCGAGCGGG No data
1134710149_1134710159 9 Left 1134710149 16:16323629-16323651 CCCTTAAGGCTGGGCCGCAGGTG No data
Right 1134710159 16:16323661-16323683 ACCCCGGGCTCCTCAGGCGGGGG No data
1134710149_1134710155 3 Left 1134710149 16:16323629-16323651 CCCTTAAGGCTGGGCCGCAGGTG No data
Right 1134710155 16:16323655-16323677 CCGTTCACCCCGGGCTCCTCAGG No data
1134710149_1134710165 24 Left 1134710149 16:16323629-16323651 CCCTTAAGGCTGGGCCGCAGGTG No data
Right 1134710165 16:16323676-16323698 GGCGGGGGGCTTCTGCCGAGCGG No data
1134710149_1134710169 30 Left 1134710149 16:16323629-16323651 CCCTTAAGGCTGGGCCGCAGGTG No data
Right 1134710169 16:16323682-16323704 GGGCTTCTGCCGAGCGGGTGGGG No data
1134710149_1134710152 -7 Left 1134710149 16:16323629-16323651 CCCTTAAGGCTGGGCCGCAGGTG No data
Right 1134710152 16:16323645-16323667 GCAGGTGCAGCCGTTCACCCCGG No data
1134710149_1134710168 29 Left 1134710149 16:16323629-16323651 CCCTTAAGGCTGGGCCGCAGGTG No data
Right 1134710168 16:16323681-16323703 GGGGCTTCTGCCGAGCGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134710149 Original CRISPR CACCTGCGGCCCAGCCTTAA GGG (reversed) Intergenic
No off target data available for this crispr