ID: 1134710150

View in Genome Browser
Species Human (GRCh38)
Location 16:16323630-16323652
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134710150_1134710167 27 Left 1134710150 16:16323630-16323652 CCTTAAGGCTGGGCCGCAGGTGC No data
Right 1134710167 16:16323680-16323702 GGGGGCTTCTGCCGAGCGGGTGG No data
1134710150_1134710168 28 Left 1134710150 16:16323630-16323652 CCTTAAGGCTGGGCCGCAGGTGC No data
Right 1134710168 16:16323681-16323703 GGGGCTTCTGCCGAGCGGGTGGG No data
1134710150_1134710159 8 Left 1134710150 16:16323630-16323652 CCTTAAGGCTGGGCCGCAGGTGC No data
Right 1134710159 16:16323661-16323683 ACCCCGGGCTCCTCAGGCGGGGG No data
1134710150_1134710152 -8 Left 1134710150 16:16323630-16323652 CCTTAAGGCTGGGCCGCAGGTGC No data
Right 1134710152 16:16323645-16323667 GCAGGTGCAGCCGTTCACCCCGG No data
1134710150_1134710158 7 Left 1134710150 16:16323630-16323652 CCTTAAGGCTGGGCCGCAGGTGC No data
Right 1134710158 16:16323660-16323682 CACCCCGGGCTCCTCAGGCGGGG No data
1134710150_1134710161 9 Left 1134710150 16:16323630-16323652 CCTTAAGGCTGGGCCGCAGGTGC No data
Right 1134710161 16:16323662-16323684 CCCCGGGCTCCTCAGGCGGGGGG No data
1134710150_1134710166 24 Left 1134710150 16:16323630-16323652 CCTTAAGGCTGGGCCGCAGGTGC No data
Right 1134710166 16:16323677-16323699 GCGGGGGGCTTCTGCCGAGCGGG No data
1134710150_1134710157 6 Left 1134710150 16:16323630-16323652 CCTTAAGGCTGGGCCGCAGGTGC No data
Right 1134710157 16:16323659-16323681 TCACCCCGGGCTCCTCAGGCGGG No data
1134710150_1134710155 2 Left 1134710150 16:16323630-16323652 CCTTAAGGCTGGGCCGCAGGTGC No data
Right 1134710155 16:16323655-16323677 CCGTTCACCCCGGGCTCCTCAGG No data
1134710150_1134710156 5 Left 1134710150 16:16323630-16323652 CCTTAAGGCTGGGCCGCAGGTGC No data
Right 1134710156 16:16323658-16323680 TTCACCCCGGGCTCCTCAGGCGG 0: 6
1: 0
2: 2
3: 11
4: 127
1134710150_1134710169 29 Left 1134710150 16:16323630-16323652 CCTTAAGGCTGGGCCGCAGGTGC No data
Right 1134710169 16:16323682-16323704 GGGCTTCTGCCGAGCGGGTGGGG No data
1134710150_1134710153 -7 Left 1134710150 16:16323630-16323652 CCTTAAGGCTGGGCCGCAGGTGC No data
Right 1134710153 16:16323646-16323668 CAGGTGCAGCCGTTCACCCCGGG No data
1134710150_1134710165 23 Left 1134710150 16:16323630-16323652 CCTTAAGGCTGGGCCGCAGGTGC No data
Right 1134710165 16:16323676-16323698 GGCGGGGGGCTTCTGCCGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134710150 Original CRISPR GCACCTGCGGCCCAGCCTTA AGG (reversed) Intergenic