ID: 1134710151

View in Genome Browser
Species Human (GRCh38)
Location 16:16323643-16323665
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134710151_1134710156 -8 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710156 16:16323658-16323680 TTCACCCCGGGCTCCTCAGGCGG 0: 6
1: 0
2: 2
3: 11
4: 127
1134710151_1134710165 10 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710165 16:16323676-16323698 GGCGGGGGGCTTCTGCCGAGCGG No data
1134710151_1134710173 26 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710173 16:16323692-16323714 CGAGCGGGTGGGGAGCAGGTGGG No data
1134710151_1134710166 11 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710166 16:16323677-16323699 GCGGGGGGCTTCTGCCGAGCGGG No data
1134710151_1134710169 16 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710169 16:16323682-16323704 GGGCTTCTGCCGAGCGGGTGGGG No data
1134710151_1134710170 22 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710170 16:16323688-16323710 CTGCCGAGCGGGTGGGGAGCAGG No data
1134710151_1134710159 -5 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710159 16:16323661-16323683 ACCCCGGGCTCCTCAGGCGGGGG No data
1134710151_1134710167 14 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710167 16:16323680-16323702 GGGGGCTTCTGCCGAGCGGGTGG No data
1134710151_1134710174 27 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710174 16:16323693-16323715 GAGCGGGTGGGGAGCAGGTGGGG No data
1134710151_1134710157 -7 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710157 16:16323659-16323681 TCACCCCGGGCTCCTCAGGCGGG No data
1134710151_1134710172 25 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710172 16:16323691-16323713 CCGAGCGGGTGGGGAGCAGGTGG No data
1134710151_1134710168 15 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710168 16:16323681-16323703 GGGGCTTCTGCCGAGCGGGTGGG No data
1134710151_1134710175 28 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710175 16:16323694-16323716 AGCGGGTGGGGAGCAGGTGGGGG No data
1134710151_1134710161 -4 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710161 16:16323662-16323684 CCCCGGGCTCCTCAGGCGGGGGG No data
1134710151_1134710158 -6 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710158 16:16323660-16323682 CACCCCGGGCTCCTCAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134710151 Original CRISPR GGGGTGAACGGCTGCACCTG CGG (reversed) Intergenic