ID: 1134710155

View in Genome Browser
Species Human (GRCh38)
Location 16:16323655-16323677
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134710140_1134710155 29 Left 1134710140 16:16323603-16323625 CCCGCACGTGGCTTGGGAGCCTG No data
Right 1134710155 16:16323655-16323677 CCGTTCACCCCGGGCTCCTCAGG No data
1134710149_1134710155 3 Left 1134710149 16:16323629-16323651 CCCTTAAGGCTGGGCCGCAGGTG No data
Right 1134710155 16:16323655-16323677 CCGTTCACCCCGGGCTCCTCAGG No data
1134710141_1134710155 28 Left 1134710141 16:16323604-16323626 CCGCACGTGGCTTGGGAGCCTGG No data
Right 1134710155 16:16323655-16323677 CCGTTCACCCCGGGCTCCTCAGG No data
1134710147_1134710155 10 Left 1134710147 16:16323622-16323644 CCTGGGACCCTTAAGGCTGGGCC No data
Right 1134710155 16:16323655-16323677 CCGTTCACCCCGGGCTCCTCAGG No data
1134710150_1134710155 2 Left 1134710150 16:16323630-16323652 CCTTAAGGCTGGGCCGCAGGTGC No data
Right 1134710155 16:16323655-16323677 CCGTTCACCCCGGGCTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134710155 Original CRISPR CCGTTCACCCCGGGCTCCTC AGG Intergenic