ID: 1134710156

View in Genome Browser
Species Human (GRCh38)
Location 16:16323658-16323680
Sequence TTCACCCCGGGCTCCTCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134710149_1134710156 6 Left 1134710149 16:16323629-16323651 CCCTTAAGGCTGGGCCGCAGGTG No data
Right 1134710156 16:16323658-16323680 TTCACCCCGGGCTCCTCAGGCGG No data
1134710151_1134710156 -8 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710156 16:16323658-16323680 TTCACCCCGGGCTCCTCAGGCGG No data
1134710150_1134710156 5 Left 1134710150 16:16323630-16323652 CCTTAAGGCTGGGCCGCAGGTGC No data
Right 1134710156 16:16323658-16323680 TTCACCCCGGGCTCCTCAGGCGG No data
1134710147_1134710156 13 Left 1134710147 16:16323622-16323644 CCTGGGACCCTTAAGGCTGGGCC No data
Right 1134710156 16:16323658-16323680 TTCACCCCGGGCTCCTCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134710156 Original CRISPR TTCACCCCGGGCTCCTCAGG CGG Intergenic