ID: 1134710163

View in Genome Browser
Species Human (GRCh38)
Location 16:16323664-16323686
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134710163_1134710173 5 Left 1134710163 16:16323664-16323686 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134710173 16:16323692-16323714 CGAGCGGGTGGGGAGCAGGTGGG No data
1134710163_1134710172 4 Left 1134710163 16:16323664-16323686 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134710172 16:16323691-16323713 CCGAGCGGGTGGGGAGCAGGTGG No data
1134710163_1134710175 7 Left 1134710163 16:16323664-16323686 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134710175 16:16323694-16323716 AGCGGGTGGGGAGCAGGTGGGGG No data
1134710163_1134710169 -5 Left 1134710163 16:16323664-16323686 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134710169 16:16323682-16323704 GGGCTTCTGCCGAGCGGGTGGGG No data
1134710163_1134710178 29 Left 1134710163 16:16323664-16323686 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134710178 16:16323716-16323738 GTGCCGCGGCTGCCCCACTTGGG No data
1134710163_1134710166 -10 Left 1134710163 16:16323664-16323686 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134710166 16:16323677-16323699 GCGGGGGGCTTCTGCCGAGCGGG No data
1134710163_1134710168 -6 Left 1134710163 16:16323664-16323686 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134710168 16:16323681-16323703 GGGGCTTCTGCCGAGCGGGTGGG No data
1134710163_1134710176 15 Left 1134710163 16:16323664-16323686 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134710176 16:16323702-16323724 GGGAGCAGGTGGGGGTGCCGCGG No data
1134710163_1134710167 -7 Left 1134710163 16:16323664-16323686 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134710167 16:16323680-16323702 GGGGGCTTCTGCCGAGCGGGTGG No data
1134710163_1134710170 1 Left 1134710163 16:16323664-16323686 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134710170 16:16323688-16323710 CTGCCGAGCGGGTGGGGAGCAGG No data
1134710163_1134710174 6 Left 1134710163 16:16323664-16323686 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134710174 16:16323693-16323715 GAGCGGGTGGGGAGCAGGTGGGG No data
1134710163_1134710177 28 Left 1134710163 16:16323664-16323686 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134710177 16:16323715-16323737 GGTGCCGCGGCTGCCCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134710163 Original CRISPR AGCCCCCCGCCTGAGGAGCC CGG (reversed) Intergenic