ID: 1134710164

View in Genome Browser
Species Human (GRCh38)
Location 16:16323671-16323693
Sequence CGGCAGAAGCCCCCCGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134710164_1134710172 -3 Left 1134710164 16:16323671-16323693 CCTCAGGCGGGGGGCTTCTGCCG No data
Right 1134710172 16:16323691-16323713 CCGAGCGGGTGGGGAGCAGGTGG No data
1134710164_1134710176 8 Left 1134710164 16:16323671-16323693 CCTCAGGCGGGGGGCTTCTGCCG No data
Right 1134710176 16:16323702-16323724 GGGAGCAGGTGGGGGTGCCGCGG No data
1134710164_1134710177 21 Left 1134710164 16:16323671-16323693 CCTCAGGCGGGGGGCTTCTGCCG No data
Right 1134710177 16:16323715-16323737 GGTGCCGCGGCTGCCCCACTTGG No data
1134710164_1134710170 -6 Left 1134710164 16:16323671-16323693 CCTCAGGCGGGGGGCTTCTGCCG No data
Right 1134710170 16:16323688-16323710 CTGCCGAGCGGGTGGGGAGCAGG No data
1134710164_1134710175 0 Left 1134710164 16:16323671-16323693 CCTCAGGCGGGGGGCTTCTGCCG No data
Right 1134710175 16:16323694-16323716 AGCGGGTGGGGAGCAGGTGGGGG No data
1134710164_1134710174 -1 Left 1134710164 16:16323671-16323693 CCTCAGGCGGGGGGCTTCTGCCG No data
Right 1134710174 16:16323693-16323715 GAGCGGGTGGGGAGCAGGTGGGG No data
1134710164_1134710173 -2 Left 1134710164 16:16323671-16323693 CCTCAGGCGGGGGGCTTCTGCCG No data
Right 1134710173 16:16323692-16323714 CGAGCGGGTGGGGAGCAGGTGGG No data
1134710164_1134710178 22 Left 1134710164 16:16323671-16323693 CCTCAGGCGGGGGGCTTCTGCCG No data
Right 1134710178 16:16323716-16323738 GTGCCGCGGCTGCCCCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134710164 Original CRISPR CGGCAGAAGCCCCCCGCCTG AGG (reversed) Intergenic