ID: 1134710167

View in Genome Browser
Species Human (GRCh38)
Location 16:16323680-16323702
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134710151_1134710167 14 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710167 16:16323680-16323702 GGGGGCTTCTGCCGAGCGGGTGG No data
1134710150_1134710167 27 Left 1134710150 16:16323630-16323652 CCTTAAGGCTGGGCCGCAGGTGC No data
Right 1134710167 16:16323680-16323702 GGGGGCTTCTGCCGAGCGGGTGG No data
1134710149_1134710167 28 Left 1134710149 16:16323629-16323651 CCCTTAAGGCTGGGCCGCAGGTG No data
Right 1134710167 16:16323680-16323702 GGGGGCTTCTGCCGAGCGGGTGG No data
1134710162_1134710167 -6 Left 1134710162 16:16323663-16323685 CCCGGGCTCCTCAGGCGGGGGGC No data
Right 1134710167 16:16323680-16323702 GGGGGCTTCTGCCGAGCGGGTGG No data
1134710154_1134710167 2 Left 1134710154 16:16323655-16323677 CCGTTCACCCCGGGCTCCTCAGG No data
Right 1134710167 16:16323680-16323702 GGGGGCTTCTGCCGAGCGGGTGG No data
1134710160_1134710167 -5 Left 1134710160 16:16323662-16323684 CCCCGGGCTCCTCAGGCGGGGGG No data
Right 1134710167 16:16323680-16323702 GGGGGCTTCTGCCGAGCGGGTGG No data
1134710163_1134710167 -7 Left 1134710163 16:16323664-16323686 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134710167 16:16323680-16323702 GGGGGCTTCTGCCGAGCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134710167 Original CRISPR GGGGGCTTCTGCCGAGCGGG TGG Intergenic
No off target data available for this crispr