ID: 1134710170

View in Genome Browser
Species Human (GRCh38)
Location 16:16323688-16323710
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134710154_1134710170 10 Left 1134710154 16:16323655-16323677 CCGTTCACCCCGGGCTCCTCAGG No data
Right 1134710170 16:16323688-16323710 CTGCCGAGCGGGTGGGGAGCAGG No data
1134710163_1134710170 1 Left 1134710163 16:16323664-16323686 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134710170 16:16323688-16323710 CTGCCGAGCGGGTGGGGAGCAGG No data
1134710151_1134710170 22 Left 1134710151 16:16323643-16323665 CCGCAGGTGCAGCCGTTCACCCC No data
Right 1134710170 16:16323688-16323710 CTGCCGAGCGGGTGGGGAGCAGG No data
1134710164_1134710170 -6 Left 1134710164 16:16323671-16323693 CCTCAGGCGGGGGGCTTCTGCCG No data
Right 1134710170 16:16323688-16323710 CTGCCGAGCGGGTGGGGAGCAGG No data
1134710162_1134710170 2 Left 1134710162 16:16323663-16323685 CCCGGGCTCCTCAGGCGGGGGGC No data
Right 1134710170 16:16323688-16323710 CTGCCGAGCGGGTGGGGAGCAGG No data
1134710160_1134710170 3 Left 1134710160 16:16323662-16323684 CCCCGGGCTCCTCAGGCGGGGGG No data
Right 1134710170 16:16323688-16323710 CTGCCGAGCGGGTGGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134710170 Original CRISPR CTGCCGAGCGGGTGGGGAGC AGG Intergenic
No off target data available for this crispr