ID: 1134710177

View in Genome Browser
Species Human (GRCh38)
Location 16:16323715-16323737
Sequence GGTGCCGCGGCTGCCCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134710164_1134710177 21 Left 1134710164 16:16323671-16323693 CCTCAGGCGGGGGGCTTCTGCCG No data
Right 1134710177 16:16323715-16323737 GGTGCCGCGGCTGCCCCACTTGG No data
1134710163_1134710177 28 Left 1134710163 16:16323664-16323686 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134710177 16:16323715-16323737 GGTGCCGCGGCTGCCCCACTTGG No data
1134710160_1134710177 30 Left 1134710160 16:16323662-16323684 CCCCGGGCTCCTCAGGCGGGGGG No data
Right 1134710177 16:16323715-16323737 GGTGCCGCGGCTGCCCCACTTGG No data
1134710171_1134710177 1 Left 1134710171 16:16323691-16323713 CCGAGCGGGTGGGGAGCAGGTGG No data
Right 1134710177 16:16323715-16323737 GGTGCCGCGGCTGCCCCACTTGG No data
1134710162_1134710177 29 Left 1134710162 16:16323663-16323685 CCCGGGCTCCTCAGGCGGGGGGC No data
Right 1134710177 16:16323715-16323737 GGTGCCGCGGCTGCCCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134710177 Original CRISPR GGTGCCGCGGCTGCCCCACT TGG Intergenic