ID: 1134710178

View in Genome Browser
Species Human (GRCh38)
Location 16:16323716-16323738
Sequence GTGCCGCGGCTGCCCCACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134710163_1134710178 29 Left 1134710163 16:16323664-16323686 CCGGGCTCCTCAGGCGGGGGGCT No data
Right 1134710178 16:16323716-16323738 GTGCCGCGGCTGCCCCACTTGGG No data
1134710162_1134710178 30 Left 1134710162 16:16323663-16323685 CCCGGGCTCCTCAGGCGGGGGGC No data
Right 1134710178 16:16323716-16323738 GTGCCGCGGCTGCCCCACTTGGG No data
1134710171_1134710178 2 Left 1134710171 16:16323691-16323713 CCGAGCGGGTGGGGAGCAGGTGG No data
Right 1134710178 16:16323716-16323738 GTGCCGCGGCTGCCCCACTTGGG No data
1134710164_1134710178 22 Left 1134710164 16:16323671-16323693 CCTCAGGCGGGGGGCTTCTGCCG No data
Right 1134710178 16:16323716-16323738 GTGCCGCGGCTGCCCCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134710178 Original CRISPR GTGCCGCGGCTGCCCCACTT GGG Intergenic
No off target data available for this crispr