ID: 1134711363

View in Genome Browser
Species Human (GRCh38)
Location 16:16328261-16328283
Sequence CACCGACGGAGGCCTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134711363_1134711370 -8 Left 1134711363 16:16328261-16328283 CCAGCCCCAGGCCTCCGTCGGTG No data
Right 1134711370 16:16328276-16328298 CGTCGGTGCTGTGGTCACCCTGG No data
1134711363_1134711373 10 Left 1134711363 16:16328261-16328283 CCAGCCCCAGGCCTCCGTCGGTG No data
Right 1134711373 16:16328294-16328316 CCTGGACAGCAGCAACCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134711363 Original CRISPR CACCGACGGAGGCCTGGGGC TGG (reversed) Intergenic
No off target data available for this crispr