ID: 1134712004

View in Genome Browser
Species Human (GRCh38)
Location 16:16331485-16331507
Sequence CCACCCTGCCCAACCTCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134712004_1134712009 5 Left 1134712004 16:16331485-16331507 CCGTGGGAGGTTGGGCAGGGTGG No data
Right 1134712009 16:16331513-16331535 CCCCGTGGCCTCCTGCAGTGCGG No data
1134712004_1134712006 -10 Left 1134712004 16:16331485-16331507 CCGTGGGAGGTTGGGCAGGGTGG No data
Right 1134712006 16:16331498-16331520 GGCAGGGTGGTCCTGCCCCGTGG No data
1134712004_1134712014 23 Left 1134712004 16:16331485-16331507 CCGTGGGAGGTTGGGCAGGGTGG No data
Right 1134712014 16:16331531-16331553 TGCGGCCCTCCCTGCCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134712004 Original CRISPR CCACCCTGCCCAACCTCCCA CGG (reversed) Intergenic
No off target data available for this crispr