ID: 1134712141

View in Genome Browser
Species Human (GRCh38)
Location 16:16332086-16332108
Sequence CACCAAAGGCTGCTCGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134712130_1134712141 13 Left 1134712130 16:16332050-16332072 CCACTTTCCAGTGCTGCAGCCAG No data
Right 1134712141 16:16332086-16332108 CACCAAAGGCTGCTCGGGAAGGG No data
1134712127_1134712141 23 Left 1134712127 16:16332040-16332062 CCCAGGGCCGCCACTTTCCAGTG No data
Right 1134712141 16:16332086-16332108 CACCAAAGGCTGCTCGGGAAGGG No data
1134712126_1134712141 28 Left 1134712126 16:16332035-16332057 CCATGCCCAGGGCCGCCACTTTC No data
Right 1134712141 16:16332086-16332108 CACCAAAGGCTGCTCGGGAAGGG No data
1134712128_1134712141 22 Left 1134712128 16:16332041-16332063 CCAGGGCCGCCACTTTCCAGTGC No data
Right 1134712141 16:16332086-16332108 CACCAAAGGCTGCTCGGGAAGGG No data
1134712133_1134712141 6 Left 1134712133 16:16332057-16332079 CCAGTGCTGCAGCCAGAGGGAAA No data
Right 1134712141 16:16332086-16332108 CACCAAAGGCTGCTCGGGAAGGG No data
1134712135_1134712141 -6 Left 1134712135 16:16332069-16332091 CCAGAGGGAAAGGCGTCCACCAA No data
Right 1134712141 16:16332086-16332108 CACCAAAGGCTGCTCGGGAAGGG No data
1134712129_1134712141 16 Left 1134712129 16:16332047-16332069 CCGCCACTTTCCAGTGCTGCAGC No data
Right 1134712141 16:16332086-16332108 CACCAAAGGCTGCTCGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134712141 Original CRISPR CACCAAAGGCTGCTCGGGAA GGG Intergenic
No off target data available for this crispr