ID: 1134714342

View in Genome Browser
Species Human (GRCh38)
Location 16:16348913-16348935
Sequence GATGGGGGCCCCACTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134714342_1134714352 22 Left 1134714342 16:16348913-16348935 CCCCACCCAGTGGGGCCCCCATC No data
Right 1134714352 16:16348958-16348980 TCCGTATTTGTAATAGCAAATGG No data
1134714342_1134714354 23 Left 1134714342 16:16348913-16348935 CCCCACCCAGTGGGGCCCCCATC No data
Right 1134714354 16:16348959-16348981 CCGTATTTGTAATAGCAAATGGG No data
1134714342_1134714351 -2 Left 1134714342 16:16348913-16348935 CCCCACCCAGTGGGGCCCCCATC No data
Right 1134714351 16:16348934-16348956 TCTAATATTCTAAGTATCAGAGG 0: 1
1: 18
2: 4
3: 20
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134714342 Original CRISPR GATGGGGGCCCCACTGGGTG GGG (reversed) Intergenic
No off target data available for this crispr