ID: 1134717600

View in Genome Browser
Species Human (GRCh38)
Location 16:16364650-16364672
Sequence GCCAGGCACATGCCACCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134717600_1134717606 3 Left 1134717600 16:16364650-16364672 CCGGCTGGTGGCATGTGCCTGGC No data
Right 1134717606 16:16364676-16364698 CGTTCCCCTACCGCTACACCTGG No data
1134717600_1134717607 4 Left 1134717600 16:16364650-16364672 CCGGCTGGTGGCATGTGCCTGGC No data
Right 1134717607 16:16364677-16364699 GTTCCCCTACCGCTACACCTGGG No data
1134717600_1134717611 11 Left 1134717600 16:16364650-16364672 CCGGCTGGTGGCATGTGCCTGGC No data
Right 1134717611 16:16364684-16364706 TACCGCTACACCTGGGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134717600 Original CRISPR GCCAGGCACATGCCACCAGC CGG (reversed) Intergenic
No off target data available for this crispr