ID: 1134719213

View in Genome Browser
Species Human (GRCh38)
Location 16:16371564-16371586
Sequence CACCGACGGAGGCCTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134719213_1134719220 -8 Left 1134719213 16:16371564-16371586 CCAGCCCCAGGCCTCCGTCGGTG No data
Right 1134719220 16:16371579-16371601 CGTCGGTGCTGTGGTCACCCTGG No data
1134719213_1134719223 10 Left 1134719213 16:16371564-16371586 CCAGCCCCAGGCCTCCGTCGGTG No data
Right 1134719223 16:16371597-16371619 CCTGGACAGCAGCAACCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134719213 Original CRISPR CACCGACGGAGGCCTGGGGC TGG (reversed) Intergenic
No off target data available for this crispr