ID: 1134719485

View in Genome Browser
Species Human (GRCh38)
Location 16:16372642-16372664
Sequence CCCGGCGGCTGTGTCTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134719477_1134719485 12 Left 1134719477 16:16372607-16372629 CCTGAGAAGGCACAGCTTGCACG No data
Right 1134719485 16:16372642-16372664 CCCGGCGGCTGTGTCTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134719485 Original CRISPR CCCGGCGGCTGTGTCTTCAC AGG Intergenic
No off target data available for this crispr