ID: 1134719861

View in Genome Browser
Species Human (GRCh38)
Location 16:16374778-16374800
Sequence CCACCCTGCCCAACCTCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134719861_1134719871 23 Left 1134719861 16:16374778-16374800 CCGTGGGAGGTTGGGCAGGGTGG No data
Right 1134719871 16:16374824-16374846 TGCGGCCCTCCCTGCCTTCTAGG No data
1134719861_1134719863 -10 Left 1134719861 16:16374778-16374800 CCGTGGGAGGTTGGGCAGGGTGG No data
Right 1134719863 16:16374791-16374813 GGCAGGGTGGTCCTGCCCCGTGG No data
1134719861_1134719866 5 Left 1134719861 16:16374778-16374800 CCGTGGGAGGTTGGGCAGGGTGG No data
Right 1134719866 16:16374806-16374828 CCCCGTGGCCTCCTGCAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134719861 Original CRISPR CCACCCTGCCCAACCTCCCA CGG (reversed) Intergenic
No off target data available for this crispr