ID: 1134719998

View in Genome Browser
Species Human (GRCh38)
Location 16:16375379-16375401
Sequence CACCAAAGGCTGCTCGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134719986_1134719998 16 Left 1134719986 16:16375340-16375362 CCGCCACTTTCCAGTGCTGCAGC No data
Right 1134719998 16:16375379-16375401 CACCAAAGGCTGCTCGGGAAGGG No data
1134719984_1134719998 23 Left 1134719984 16:16375333-16375355 CCCAGGGCCGCCACTTTCCAGTG No data
Right 1134719998 16:16375379-16375401 CACCAAAGGCTGCTCGGGAAGGG No data
1134719983_1134719998 28 Left 1134719983 16:16375328-16375350 CCATGCCCAGGGCCGCCACTTTC No data
Right 1134719998 16:16375379-16375401 CACCAAAGGCTGCTCGGGAAGGG No data
1134719987_1134719998 13 Left 1134719987 16:16375343-16375365 CCACTTTCCAGTGCTGCAGCCAG No data
Right 1134719998 16:16375379-16375401 CACCAAAGGCTGCTCGGGAAGGG No data
1134719985_1134719998 22 Left 1134719985 16:16375334-16375356 CCAGGGCCGCCACTTTCCAGTGC No data
Right 1134719998 16:16375379-16375401 CACCAAAGGCTGCTCGGGAAGGG No data
1134719990_1134719998 6 Left 1134719990 16:16375350-16375372 CCAGTGCTGCAGCCAGAGGGAAA No data
Right 1134719998 16:16375379-16375401 CACCAAAGGCTGCTCGGGAAGGG No data
1134719992_1134719998 -6 Left 1134719992 16:16375362-16375384 CCAGAGGGAAAGGCGTCCACCAA No data
Right 1134719998 16:16375379-16375401 CACCAAAGGCTGCTCGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134719998 Original CRISPR CACCAAAGGCTGCTCGGGAA GGG Intergenic
No off target data available for this crispr