ID: 1134729552

View in Genome Browser
Species Human (GRCh38)
Location 16:16449730-16449752
Sequence AAGGTACCACCTTAGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134729552_1134729554 -9 Left 1134729552 16:16449730-16449752 CCTTGCTTCTAAGGTGGTACCTT No data
Right 1134729554 16:16449744-16449766 TGGTACCTTGTGTCCTCTGGAGG No data
1134729552_1134729558 18 Left 1134729552 16:16449730-16449752 CCTTGCTTCTAAGGTGGTACCTT No data
Right 1134729558 16:16449771-16449793 GAATGCTGTATCCTCATATGTGG No data
1134729552_1134729562 30 Left 1134729552 16:16449730-16449752 CCTTGCTTCTAAGGTGGTACCTT No data
Right 1134729562 16:16449783-16449805 CTCATATGTGGAAGTTGGAAGGG No data
1134729552_1134729555 -8 Left 1134729552 16:16449730-16449752 CCTTGCTTCTAAGGTGGTACCTT No data
Right 1134729555 16:16449745-16449767 GGTACCTTGTGTCCTCTGGAGGG No data
1134729552_1134729559 25 Left 1134729552 16:16449730-16449752 CCTTGCTTCTAAGGTGGTACCTT No data
Right 1134729559 16:16449778-16449800 GTATCCTCATATGTGGAAGTTGG No data
1134729552_1134729561 29 Left 1134729552 16:16449730-16449752 CCTTGCTTCTAAGGTGGTACCTT No data
Right 1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134729552 Original CRISPR AAGGTACCACCTTAGAAGCA AGG (reversed) Intergenic
No off target data available for this crispr