ID: 1134729556

View in Genome Browser
Species Human (GRCh38)
Location 16:16449749-16449771
Sequence CATGCCCTCCAGAGGACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134729556_1134729559 6 Left 1134729556 16:16449749-16449771 CCTTGTGTCCTCTGGAGGGCATG No data
Right 1134729559 16:16449778-16449800 GTATCCTCATATGTGGAAGTTGG No data
1134729556_1134729562 11 Left 1134729556 16:16449749-16449771 CCTTGTGTCCTCTGGAGGGCATG No data
Right 1134729562 16:16449783-16449805 CTCATATGTGGAAGTTGGAAGGG No data
1134729556_1134729564 19 Left 1134729556 16:16449749-16449771 CCTTGTGTCCTCTGGAGGGCATG No data
Right 1134729564 16:16449791-16449813 TGGAAGTTGGAAGGGCAAAAGGG No data
1134729556_1134729561 10 Left 1134729556 16:16449749-16449771 CCTTGTGTCCTCTGGAGGGCATG No data
Right 1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG No data
1134729556_1134729558 -1 Left 1134729556 16:16449749-16449771 CCTTGTGTCCTCTGGAGGGCATG No data
Right 1134729558 16:16449771-16449793 GAATGCTGTATCCTCATATGTGG No data
1134729556_1134729563 18 Left 1134729556 16:16449749-16449771 CCTTGTGTCCTCTGGAGGGCATG No data
Right 1134729563 16:16449790-16449812 GTGGAAGTTGGAAGGGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134729556 Original CRISPR CATGCCCTCCAGAGGACACA AGG (reversed) Intergenic
No off target data available for this crispr