ID: 1134729557

View in Genome Browser
Species Human (GRCh38)
Location 16:16449757-16449779
Sequence ACAGCATTCATGCCCTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134729557_1134729558 -9 Left 1134729557 16:16449757-16449779 CCTCTGGAGGGCATGAATGCTGT No data
Right 1134729558 16:16449771-16449793 GAATGCTGTATCCTCATATGTGG No data
1134729557_1134729563 10 Left 1134729557 16:16449757-16449779 CCTCTGGAGGGCATGAATGCTGT No data
Right 1134729563 16:16449790-16449812 GTGGAAGTTGGAAGGGCAAAAGG No data
1134729557_1134729559 -2 Left 1134729557 16:16449757-16449779 CCTCTGGAGGGCATGAATGCTGT No data
Right 1134729559 16:16449778-16449800 GTATCCTCATATGTGGAAGTTGG No data
1134729557_1134729561 2 Left 1134729557 16:16449757-16449779 CCTCTGGAGGGCATGAATGCTGT No data
Right 1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG No data
1134729557_1134729562 3 Left 1134729557 16:16449757-16449779 CCTCTGGAGGGCATGAATGCTGT No data
Right 1134729562 16:16449783-16449805 CTCATATGTGGAAGTTGGAAGGG No data
1134729557_1134729564 11 Left 1134729557 16:16449757-16449779 CCTCTGGAGGGCATGAATGCTGT No data
Right 1134729564 16:16449791-16449813 TGGAAGTTGGAAGGGCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134729557 Original CRISPR ACAGCATTCATGCCCTCCAG AGG (reversed) Intergenic
No off target data available for this crispr