ID: 1134729561

View in Genome Browser
Species Human (GRCh38)
Location 16:16449782-16449804
Sequence CCTCATATGTGGAAGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134729552_1134729561 29 Left 1134729552 16:16449730-16449752 CCTTGCTTCTAAGGTGGTACCTT No data
Right 1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG No data
1134729557_1134729561 2 Left 1134729557 16:16449757-16449779 CCTCTGGAGGGCATGAATGCTGT No data
Right 1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG No data
1134729556_1134729561 10 Left 1134729556 16:16449749-16449771 CCTTGTGTCCTCTGGAGGGCATG No data
Right 1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134729561 Original CRISPR CCTCATATGTGGAAGTTGGA AGG Intergenic
No off target data available for this crispr