ID: 1134731542

View in Genome Browser
Species Human (GRCh38)
Location 16:16466299-16466321
Sequence CAACATAAGGAAAAGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134731542_1134731546 -4 Left 1134731542 16:16466299-16466321 CCAGCCTTCTTTTCCTTATGTTG No data
Right 1134731546 16:16466318-16466340 GTTGGTTTTTCTGCCACAAAAGG No data
1134731542_1134731551 25 Left 1134731542 16:16466299-16466321 CCAGCCTTCTTTTCCTTATGTTG No data
Right 1134731551 16:16466347-16466369 GACATTGTCTATGGAACGTTTGG No data
1134731542_1134731548 16 Left 1134731542 16:16466299-16466321 CCAGCCTTCTTTTCCTTATGTTG No data
Right 1134731548 16:16466338-16466360 AGGCCCAGAGACATTGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134731542 Original CRISPR CAACATAAGGAAAAGAAGGC TGG (reversed) Intergenic
No off target data available for this crispr