ID: 1134734514

View in Genome Browser
Species Human (GRCh38)
Location 16:16489506-16489528
Sequence ACGCCCTACCCAAGGTCGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134734512_1134734514 -10 Left 1134734512 16:16489493-16489515 CCTGAGTGGCGGAACGCCCTACC No data
Right 1134734514 16:16489506-16489528 ACGCCCTACCCAAGGTCGCATGG No data
1134734507_1134734514 17 Left 1134734507 16:16489466-16489488 CCCCTTGTTTGTAGATGGGGAAA No data
Right 1134734514 16:16489506-16489528 ACGCCCTACCCAAGGTCGCATGG No data
1134734508_1134734514 16 Left 1134734508 16:16489467-16489489 CCCTTGTTTGTAGATGGGGAAAC No data
Right 1134734514 16:16489506-16489528 ACGCCCTACCCAAGGTCGCATGG No data
1134734509_1134734514 15 Left 1134734509 16:16489468-16489490 CCTTGTTTGTAGATGGGGAAACT No data
Right 1134734514 16:16489506-16489528 ACGCCCTACCCAAGGTCGCATGG No data
1134734503_1134734514 28 Left 1134734503 16:16489455-16489477 CCGTGTCTATTCCCCTTGTTTGT No data
Right 1134734514 16:16489506-16489528 ACGCCCTACCCAAGGTCGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134734514 Original CRISPR ACGCCCTACCCAAGGTCGCA TGG Intergenic
No off target data available for this crispr