ID: 1134738554

View in Genome Browser
Species Human (GRCh38)
Location 16:16521701-16521723
Sequence CGAGTAGATTACCTGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134738554_1134738556 -1 Left 1134738554 16:16521701-16521723 CCTGACTTCAGGTAATCTACTCG No data
Right 1134738556 16:16521723-16521745 GCCTAGGCCTCCCAAAGTGCTGG 0: 1710
1: 139495
2: 236625
3: 201008
4: 123347
1134738554_1134738559 1 Left 1134738554 16:16521701-16521723 CCTGACTTCAGGTAATCTACTCG No data
Right 1134738559 16:16521725-16521747 CTAGGCCTCCCAAAGTGCTGGGG 0: 63
1: 3386
2: 5458
3: 4424
4: 3219
1134738554_1134738562 9 Left 1134738554 16:16521701-16521723 CCTGACTTCAGGTAATCTACTCG No data
Right 1134738562 16:16521733-16521755 CCCAAAGTGCTGGGGATTACAGG 0: 247
1: 530
2: 974
3: 1352
4: 2265
1134738554_1134738564 28 Left 1134738554 16:16521701-16521723 CCTGACTTCAGGTAATCTACTCG No data
Right 1134738564 16:16521752-16521774 CAGGCATGAGCTATCGCATCCGG No data
1134738554_1134738558 0 Left 1134738554 16:16521701-16521723 CCTGACTTCAGGTAATCTACTCG No data
Right 1134738558 16:16521724-16521746 CCTAGGCCTCCCAAAGTGCTGGG 0: 2955
1: 212102
2: 268029
3: 175708
4: 97317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134738554 Original CRISPR CGAGTAGATTACCTGAAGTC AGG (reversed) Intergenic
No off target data available for this crispr