ID: 1134752428

View in Genome Browser
Species Human (GRCh38)
Location 16:16636583-16636605
Sequence GTGCAGGAGCAGAGTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134752428_1134752434 26 Left 1134752428 16:16636583-16636605 CCTTGCCCACTCTGCTCCTGCAC No data
Right 1134752434 16:16636632-16636654 CCACACTCAATCCCACCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134752428 Original CRISPR GTGCAGGAGCAGAGTGGGCA AGG (reversed) Intergenic
No off target data available for this crispr