ID: 1134752434

View in Genome Browser
Species Human (GRCh38)
Location 16:16636632-16636654
Sequence CCACACTCAATCCCACCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134752431_1134752434 20 Left 1134752431 16:16636589-16636611 CCACTCTGCTCCTGCACTGGTGA No data
Right 1134752434 16:16636632-16636654 CCACACTCAATCCCACCTTGTGG No data
1134752430_1134752434 21 Left 1134752430 16:16636588-16636610 CCCACTCTGCTCCTGCACTGGTG No data
Right 1134752434 16:16636632-16636654 CCACACTCAATCCCACCTTGTGG No data
1134752428_1134752434 26 Left 1134752428 16:16636583-16636605 CCTTGCCCACTCTGCTCCTGCAC No data
Right 1134752434 16:16636632-16636654 CCACACTCAATCCCACCTTGTGG No data
1134752432_1134752434 10 Left 1134752432 16:16636599-16636621 CCTGCACTGGTGACAGTTCAGCT No data
Right 1134752434 16:16636632-16636654 CCACACTCAATCCCACCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134752434 Original CRISPR CCACACTCAATCCCACCTTG TGG Intergenic
No off target data available for this crispr