ID: 1134756822

View in Genome Browser
Species Human (GRCh38)
Location 16:16674565-16674587
Sequence CCACTTTCCCTGCCAACGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134756822_1134756834 21 Left 1134756822 16:16674565-16674587 CCTGACGTTGGCAGGGAAAGTGG No data
Right 1134756834 16:16674609-16674631 GGGAGATTTTAGAGAGTTACAGG No data
1134756822_1134756825 0 Left 1134756822 16:16674565-16674587 CCTGACGTTGGCAGGGAAAGTGG No data
Right 1134756825 16:16674588-16674610 TCCCCACCCCTAGTCCAAGGAGG No data
1134756822_1134756837 24 Left 1134756822 16:16674565-16674587 CCTGACGTTGGCAGGGAAAGTGG No data
Right 1134756837 16:16674612-16674634 AGATTTTAGAGAGTTACAGGGGG No data
1134756822_1134756827 1 Left 1134756822 16:16674565-16674587 CCTGACGTTGGCAGGGAAAGTGG No data
Right 1134756827 16:16674589-16674611 CCCCACCCCTAGTCCAAGGAGGG No data
1134756822_1134756835 22 Left 1134756822 16:16674565-16674587 CCTGACGTTGGCAGGGAAAGTGG No data
Right 1134756835 16:16674610-16674632 GGAGATTTTAGAGAGTTACAGGG No data
1134756822_1134756824 -3 Left 1134756822 16:16674565-16674587 CCTGACGTTGGCAGGGAAAGTGG No data
Right 1134756824 16:16674585-16674607 TGGTCCCCACCCCTAGTCCAAGG No data
1134756822_1134756836 23 Left 1134756822 16:16674565-16674587 CCTGACGTTGGCAGGGAAAGTGG No data
Right 1134756836 16:16674611-16674633 GAGATTTTAGAGAGTTACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134756822 Original CRISPR CCACTTTCCCTGCCAACGTC AGG (reversed) Intergenic
No off target data available for this crispr