ID: 1134759144

View in Genome Browser
Species Human (GRCh38)
Location 16:16698217-16698239
Sequence GAGGGGGCAGGGAGGAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134759144_1134759148 -9 Left 1134759144 16:16698217-16698239 CCTGGGCTCCTCCCTGCCCCCTC No data
Right 1134759148 16:16698231-16698253 TGCCCCCTCCCCTGTGCCCCTGG No data
1134759144_1134759149 -8 Left 1134759144 16:16698217-16698239 CCTGGGCTCCTCCCTGCCCCCTC No data
Right 1134759149 16:16698232-16698254 GCCCCCTCCCCTGTGCCCCTGGG No data
1134759144_1134759158 6 Left 1134759144 16:16698217-16698239 CCTGGGCTCCTCCCTGCCCCCTC No data
Right 1134759158 16:16698246-16698268 GCCCCTGGGTTGGAAGATGAAGG No data
1134759144_1134759154 -4 Left 1134759144 16:16698217-16698239 CCTGGGCTCCTCCCTGCCCCCTC No data
Right 1134759154 16:16698236-16698258 CCTCCCCTGTGCCCCTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134759144 Original CRISPR GAGGGGGCAGGGAGGAGCCC AGG (reversed) Intergenic
No off target data available for this crispr