ID: 1134759146

View in Genome Browser
Species Human (GRCh38)
Location 16:16698228-16698250
Sequence GGGGCACAGGGGAGGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134759146_1134759158 -5 Left 1134759146 16:16698228-16698250 CCCTGCCCCCTCCCCTGTGCCCC No data
Right 1134759158 16:16698246-16698268 GCCCCTGGGTTGGAAGATGAAGG No data
1134759146_1134759162 29 Left 1134759146 16:16698228-16698250 CCCTGCCCCCTCCCCTGTGCCCC No data
Right 1134759162 16:16698280-16698302 GAGACAAATGCTTATGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134759146 Original CRISPR GGGGCACAGGGGAGGGGGCA GGG (reversed) Intergenic