ID: 1134759147

View in Genome Browser
Species Human (GRCh38)
Location 16:16698229-16698251
Sequence AGGGGCACAGGGGAGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134759147_1134759158 -6 Left 1134759147 16:16698229-16698251 CCTGCCCCCTCCCCTGTGCCCCT No data
Right 1134759158 16:16698246-16698268 GCCCCTGGGTTGGAAGATGAAGG No data
1134759147_1134759162 28 Left 1134759147 16:16698229-16698251 CCTGCCCCCTCCCCTGTGCCCCT No data
Right 1134759162 16:16698280-16698302 GAGACAAATGCTTATGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134759147 Original CRISPR AGGGGCACAGGGGAGGGGGC AGG (reversed) Intergenic
No off target data available for this crispr