ID: 1134759149

View in Genome Browser
Species Human (GRCh38)
Location 16:16698232-16698254
Sequence GCCCCCTCCCCTGTGCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134759144_1134759149 -8 Left 1134759144 16:16698217-16698239 CCTGGGCTCCTCCCTGCCCCCTC No data
Right 1134759149 16:16698232-16698254 GCCCCCTCCCCTGTGCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134759149 Original CRISPR GCCCCCTCCCCTGTGCCCCT GGG Intergenic