ID: 1134759150

View in Genome Browser
Species Human (GRCh38)
Location 16:16698233-16698255
Sequence ACCCAGGGGCACAGGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134759150_1134759162 24 Left 1134759150 16:16698233-16698255 CCCCCTCCCCTGTGCCCCTGGGT No data
Right 1134759162 16:16698280-16698302 GAGACAAATGCTTATGAGTGAGG No data
1134759150_1134759163 30 Left 1134759150 16:16698233-16698255 CCCCCTCCCCTGTGCCCCTGGGT No data
Right 1134759163 16:16698286-16698308 AATGCTTATGAGTGAGGTTATGG No data
1134759150_1134759158 -10 Left 1134759150 16:16698233-16698255 CCCCCTCCCCTGTGCCCCTGGGT No data
Right 1134759158 16:16698246-16698268 GCCCCTGGGTTGGAAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134759150 Original CRISPR ACCCAGGGGCACAGGGGAGG GGG (reversed) Intergenic
No off target data available for this crispr