ID: 1134759154

View in Genome Browser
Species Human (GRCh38)
Location 16:16698236-16698258
Sequence CCTCCCCTGTGCCCCTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134759144_1134759154 -4 Left 1134759144 16:16698217-16698239 CCTGGGCTCCTCCCTGCCCCCTC No data
Right 1134759154 16:16698236-16698258 CCTCCCCTGTGCCCCTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134759154 Original CRISPR CCTCCCCTGTGCCCCTGGGT TGG Intergenic