ID: 1134759158

View in Genome Browser
Species Human (GRCh38)
Location 16:16698246-16698268
Sequence GCCCCTGGGTTGGAAGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134759145_1134759158 -2 Left 1134759145 16:16698225-16698247 CCTCCCTGCCCCCTCCCCTGTGC No data
Right 1134759158 16:16698246-16698268 GCCCCTGGGTTGGAAGATGAAGG No data
1134759144_1134759158 6 Left 1134759144 16:16698217-16698239 CCTGGGCTCCTCCCTGCCCCCTC No data
Right 1134759158 16:16698246-16698268 GCCCCTGGGTTGGAAGATGAAGG No data
1134759150_1134759158 -10 Left 1134759150 16:16698233-16698255 CCCCCTCCCCTGTGCCCCTGGGT No data
Right 1134759158 16:16698246-16698268 GCCCCTGGGTTGGAAGATGAAGG No data
1134759147_1134759158 -6 Left 1134759147 16:16698229-16698251 CCTGCCCCCTCCCCTGTGCCCCT No data
Right 1134759158 16:16698246-16698268 GCCCCTGGGTTGGAAGATGAAGG No data
1134759146_1134759158 -5 Left 1134759146 16:16698228-16698250 CCCTGCCCCCTCCCCTGTGCCCC No data
Right 1134759158 16:16698246-16698268 GCCCCTGGGTTGGAAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134759158 Original CRISPR GCCCCTGGGTTGGAAGATGA AGG Intergenic
No off target data available for this crispr