ID: 1134759159

View in Genome Browser
Species Human (GRCh38)
Location 16:16698247-16698269
Sequence TCCTTCATCTTCCAACCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134759159_1134759164 17 Left 1134759159 16:16698247-16698269 CCCCTGGGTTGGAAGATGAAGGA No data
Right 1134759164 16:16698287-16698309 ATGCTTATGAGTGAGGTTATGGG No data
1134759159_1134759163 16 Left 1134759159 16:16698247-16698269 CCCCTGGGTTGGAAGATGAAGGA No data
Right 1134759163 16:16698286-16698308 AATGCTTATGAGTGAGGTTATGG No data
1134759159_1134759162 10 Left 1134759159 16:16698247-16698269 CCCCTGGGTTGGAAGATGAAGGA No data
Right 1134759162 16:16698280-16698302 GAGACAAATGCTTATGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134759159 Original CRISPR TCCTTCATCTTCCAACCCAG GGG (reversed) Intergenic
No off target data available for this crispr