ID: 1134759161

View in Genome Browser
Species Human (GRCh38)
Location 16:16698249-16698271
Sequence ATTCCTTCATCTTCCAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134759161_1134759163 14 Left 1134759161 16:16698249-16698271 CCTGGGTTGGAAGATGAAGGAAT No data
Right 1134759163 16:16698286-16698308 AATGCTTATGAGTGAGGTTATGG No data
1134759161_1134759164 15 Left 1134759161 16:16698249-16698271 CCTGGGTTGGAAGATGAAGGAAT No data
Right 1134759164 16:16698287-16698309 ATGCTTATGAGTGAGGTTATGGG No data
1134759161_1134759162 8 Left 1134759161 16:16698249-16698271 CCTGGGTTGGAAGATGAAGGAAT No data
Right 1134759162 16:16698280-16698302 GAGACAAATGCTTATGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134759161 Original CRISPR ATTCCTTCATCTTCCAACCC AGG (reversed) Intergenic
No off target data available for this crispr