ID: 1134759164

View in Genome Browser
Species Human (GRCh38)
Location 16:16698287-16698309
Sequence ATGCTTATGAGTGAGGTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134759161_1134759164 15 Left 1134759161 16:16698249-16698271 CCTGGGTTGGAAGATGAAGGAAT No data
Right 1134759164 16:16698287-16698309 ATGCTTATGAGTGAGGTTATGGG No data
1134759153_1134759164 28 Left 1134759153 16:16698236-16698258 CCTCCCCTGTGCCCCTGGGTTGG No data
Right 1134759164 16:16698287-16698309 ATGCTTATGAGTGAGGTTATGGG No data
1134759151_1134759164 30 Left 1134759151 16:16698234-16698256 CCCCTCCCCTGTGCCCCTGGGTT No data
Right 1134759164 16:16698287-16698309 ATGCTTATGAGTGAGGTTATGGG No data
1134759155_1134759164 25 Left 1134759155 16:16698239-16698261 CCCCTGTGCCCCTGGGTTGGAAG No data
Right 1134759164 16:16698287-16698309 ATGCTTATGAGTGAGGTTATGGG No data
1134759152_1134759164 29 Left 1134759152 16:16698235-16698257 CCCTCCCCTGTGCCCCTGGGTTG No data
Right 1134759164 16:16698287-16698309 ATGCTTATGAGTGAGGTTATGGG No data
1134759160_1134759164 16 Left 1134759160 16:16698248-16698270 CCCTGGGTTGGAAGATGAAGGAA No data
Right 1134759164 16:16698287-16698309 ATGCTTATGAGTGAGGTTATGGG No data
1134759159_1134759164 17 Left 1134759159 16:16698247-16698269 CCCCTGGGTTGGAAGATGAAGGA No data
Right 1134759164 16:16698287-16698309 ATGCTTATGAGTGAGGTTATGGG No data
1134759157_1134759164 23 Left 1134759157 16:16698241-16698263 CCTGTGCCCCTGGGTTGGAAGAT No data
Right 1134759164 16:16698287-16698309 ATGCTTATGAGTGAGGTTATGGG No data
1134759156_1134759164 24 Left 1134759156 16:16698240-16698262 CCCTGTGCCCCTGGGTTGGAAGA No data
Right 1134759164 16:16698287-16698309 ATGCTTATGAGTGAGGTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134759164 Original CRISPR ATGCTTATGAGTGAGGTTAT GGG Intergenic
No off target data available for this crispr