ID: 1134760223

View in Genome Browser
Species Human (GRCh38)
Location 16:16707934-16707956
Sequence CCTAATTATCACAGTCCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134760223_1134760229 26 Left 1134760223 16:16707934-16707956 CCTTAAGGACTGTGATAATTAGG No data
Right 1134760229 16:16707983-16708005 CTTGCAAAAAGGAAACCAGAGGG No data
1134760223_1134760228 25 Left 1134760223 16:16707934-16707956 CCTTAAGGACTGTGATAATTAGG No data
Right 1134760228 16:16707982-16708004 ACTTGCAAAAAGGAAACCAGAGG No data
1134760223_1134760227 15 Left 1134760223 16:16707934-16707956 CCTTAAGGACTGTGATAATTAGG No data
Right 1134760227 16:16707972-16707994 TTTTGCTGAGACTTGCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134760223 Original CRISPR CCTAATTATCACAGTCCTTA AGG (reversed) Intergenic
No off target data available for this crispr