ID: 1134764114

View in Genome Browser
Species Human (GRCh38)
Location 16:16741400-16741422
Sequence CCATGATGCTTGGCAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134764114_1134764120 20 Left 1134764114 16:16741400-16741422 CCTGTGTTTGCCAAGCATCATGG No data
Right 1134764120 16:16741443-16741465 CCACATGAAACCCCTGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134764114 Original CRISPR CCATGATGCTTGGCAAACAC AGG (reversed) Intergenic
No off target data available for this crispr