ID: 1134765232

View in Genome Browser
Species Human (GRCh38)
Location 16:16751617-16751639
Sequence GCAACTTGTCACATTCAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134765232_1134765244 27 Left 1134765232 16:16751617-16751639 CCTTATTGAATGTGACAAGTTGC No data
Right 1134765244 16:16751667-16751689 AGGATGAAAGTCACTCTTTGTGG No data
1134765232_1134765238 7 Left 1134765232 16:16751617-16751639 CCTTATTGAATGTGACAAGTTGC No data
Right 1134765238 16:16751647-16751669 GGCCCCTGCTTCTTAGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134765232 Original CRISPR GCAACTTGTCACATTCAATA AGG (reversed) Intergenic
No off target data available for this crispr