ID: 1134765694

View in Genome Browser
Species Human (GRCh38)
Location 16:16755727-16755749
Sequence CTCAGGGAGGGGAAGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134765694_1134765708 16 Left 1134765694 16:16755727-16755749 CCCTTCCCCTTCCCCTCCCTGAG No data
Right 1134765708 16:16755766-16755788 CAGACTAGAGTGCAGTGGCATGG No data
1134765694_1134765705 11 Left 1134765694 16:16755727-16755749 CCCTTCCCCTTCCCCTCCCTGAG No data
Right 1134765705 16:16755761-16755783 TTACCCAGACTAGAGTGCAGTGG 0: 20
1: 1080
2: 22570
3: 192361
4: 295239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134765694 Original CRISPR CTCAGGGAGGGGAAGGGGAA GGG (reversed) Intergenic
No off target data available for this crispr