ID: 1134766439

View in Genome Browser
Species Human (GRCh38)
Location 16:16762939-16762961
Sequence CTGTAGCTCCAGCACTCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134766439_1134766444 -3 Left 1134766439 16:16762939-16762961 CCCCCTGAGTGCTGGAGCTACAG No data
Right 1134766444 16:16762959-16762981 CAGGTATGTGCTACCATGCCTGG 0: 15
1: 708
2: 10542
3: 44428
4: 112512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134766439 Original CRISPR CTGTAGCTCCAGCACTCAGG GGG (reversed) Intergenic
No off target data available for this crispr